Volume 31, Issue 144 (January & February 2023)                   J Adv Med Biomed Res 2023, 31(144): 46-56 | Back to browse issues page


XML Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Karimi Moghaddam Z, Karimkhanilouei S, Asaadi Tehrani G. Association between Polymorphisms of X-ray Repair Cross Complementing 5 and 6 Promoter Genes and the Risk of Metastatic Breast Cancer. J Adv Med Biomed Res 2023; 31 (144) :46-56
URL: http://journal.zums.ac.ir/article-1-6670-en.html
1- Dept of Radiation Oncology, Vali- e-Asr Hospital, School of Medicine, Zanjan University of Medical Sciences, Zanjan, Iran
2- Dept. of Genetics, Zanjan Branch, Islamic Azad University, Zanjan, Iran
3- Dept. of Genetics, Zanjan Branch, Islamic Azad University, Zanjan, Iran , Drgolnazasaadi@gmail.com
Full-Text [PDF 496 kb]   (10822 Downloads)     |   Abstract (HTML)  (12832 Views)

✅ We speculate that the genetic variation of the XRCC6 gene (rs132793 SNP) might be considered as a diagnostic biomarker in breast cancer, but further studies are necessary to confirm the results.


Full-Text:   (1182 Views)
Introduction
 

Nowadays, cancer has become one of the major health challenges worldwide. Indeed, cancer is mainly associated with a class of pathological conditions, leading to altered cellular processes and subsequently resulting in uncontrolled cellular growth and division. Among various types of cancer, breast cancer is the most common type in women and is known as the second cause of mortality after lung cancer (1). Metastasis is defined as the spread of tumor cells and their movement from the initial site to other tissues and organs in different sites of the body (2, 3). The metastatic property of cancer cells is a major challenge, hindering the efficient treatment of cancer (3). The mechanism of breast cancer metastasis mainly involves metastatic cascade, invasion, migration, motility, and tumor microenvironment adaption (4-10). It has been proved that cancer is mainly related to genetic abnormalities and mutation in certain genes, as well as changes in the expression of cell cycle-related genes, which could principally start tumor generation or metastasis (11). Single nucleotide polymorphisms (SNPs) are considered the most prevalent genetic modification, demonstrating a distinctive change in a single nucleotide. Genetic polymorphism is defined as a difference in DNA sequences, determining the variation of organisms in higher levels of integration (12-14).
DNA double-strand break (DSB) is the most threatening form of genomic integrity, and its inactivation leads to uncontrolled cell growth and cancer progression (15). DSB repair involves non-homologous end-joining (NHEJ) and homologous recombination (HR). The identification of breast cancer gene 1 (BRCA1) and BRCA2 (familial breast cancer susceptibility genes) function in the HR repair mechanism should be investigated. On the other hand, defects of the NHEJ pathway could be considered a risk factor for the formation of breast tumors (16, 17). The NHEJ pathway comprises multiple genes (such as X-ray repair cross complementing 4 [XRCC4], XRCC5, and XRCC6) associated with DSB repair. Ku protein is a heterodimeric DNA-binding complex capable of DSB repair in the process of the NHEJ pathway. This complex comprises Ku70 and Ku86 as 2 main subunits encoded by XRCC5 and XRCC6 (18). Ku is well-known as a main DSB repair complex and initiates the repair process through the NHEJ pathway. Ku consists of 2 subunits, Ku70 (encoded by XRCC6) and Ku86 (encoded by XRCC5). Various studies have investigated the association between various cancers (such as lung, cervical, prostate, and oral cancers) and polymorphisms of XRCC6 and XRCC5 genes (19, 20). Some studies have focused on breast cancer and found that the genotypes of XRCC5 (1R/0R) and XRCC7 (6721 G/T) significantly increased the risk of breast cancer (21-23). Given the pivotal role of Ku in breast tumorigenesis and tumor progression (24), the evaluation of genetic variants in these subunits encoding genes could be a key issue in breast cancer predisposition. In this regard, the main aim of this study was to investigate the relationship between rs132793 and rs6147172 polymorphisms in XRCC6 and XRCC5 genes, respectively. This study was conducted on 30 cases with metastatic breast cancer undergoing chemotherapy.

 

 

Materials and Methods

Study Population

Thirty women aged 25-69 years with metastatic breast cancer diagnosed by clinical and pathological trials were included in this study. Patients were receiving several medical therapeutic procedures, including surgery, radiotherapy, and chemotherapy, adhering to the ethical principles of the Oncology Department of Valiasr Hospital in Zanjan Province (Iran). In addition, 30 healthy women were included as control subjects with negative mammography and ultrasonic results and no breast mass or metastasis. These subjects were selected by the Milad Pathobiology Laboratory in Zanjan Province.

Evaluation of Clinical Features 

The frequency of the patient’s clinical data included age, body mass index (BMI), menopausal age, age at first pregnancy, age of infection, pre-menopausal infection, familial history, estrogen/progesterone receptor, P53, human epithelial receptor 2 (HER2), tumor degree, contraceptive consumption, stress level, metastasis, diet, activity level, time interval between initial chemotherapy and disease recurrence, and radiotherapy sessions.

Clinical Information

A questionnaire was used to record the demographic, clinical, and pathological information of the subjects. This information included age, height, weight, alcohol consumption, smoking, diet, age at first birth, number of chemotherapy/radiotherapy sessions, metastasis, familial history of cancer, abdominal surgery, and contraceptive consumption. It should be noted that the type of chemotherapeutic agents, types of tumor cells, and grade of cancer were obtained from the patients’ records.
This study was approved by the Ethics Committee of Islamic Azad University of Zanjan (code: IR.IAU.REC.1396.59).

Peripheral Blood Sampling and DNA Extraction

Peripheral blood (2 mL) was taken from the axillary vein of each subject. The blood was poured into the vial containing EDTA, followed by a vigorous shake. Then, the samples were stored at -20 °C for further analysis.
DNA was extracted using standard Bio basic and Cinna Gene kits according to the company protocol. The purity of the extracted DNA was measured by gel electrophoresis. DNA concentration and quality were examined by spectrophotometry.

Tetra-ARMS and High-Resolution Melt Real-Time Polymerase Chain Reaction

Tetra-ARMS polymerase chain reaction (PCR) was used to evaluate the expression of the XRCC6 gene, and high-resolution melt (HRM) real-time PCR was performed to detect variable number tandem repeat (VNTR) in the XRCC5 gene. A RealQ Plus Master Mix Green Kit was used according to the manufacturer’s instructions. The sequences of the used primers for XRCC6 (rs132793) included inner primer (A allele): forward primer 5ʹ- ACTGCCCCTGACTGTAAGGA-CCCGGA-3ʹ, inner primer (G allele): reverse primer 5ʹ- CTTCCATACATGATGCAGAGAAGGTTGAAC -3ʹ, forward outer primer: 5ʹ-AAAAAAACAGAAGAAAG-GCAGGGCAGGA-3ʹ, and reverse outer primer: 5ʹ-ATGGTCATGCTAAAATTGC AGGGTAGCG-3ʹ. The sequences of the used primers for VNTR (rs6147172) included forward 5ʹ-AGGCGGCTCAAA CACCACAC-3ʹ and reverse 5ʹ- CAAGCGGCAGATAGCGGAAAG-3ʹ.

Statistical Analysis

Allelic frequencies and polymorphisms in all subjects were assessed and analyzed using SPSS version 20 (SPSS Inc, Chicago, Ill, USA). The results were analyzed using the K2 score and Fisher`s method. P values less than 0.05 were considered statistically significant.

 
 
Results

Thirty patients with metastatic breast cancer and 30 control subjects were enrolled in this study. Control subjects had no mass in their breast tissue, and their mammography or ultrasound findings were negative.

Genotypic Analysis of XRCC5

Eight samples of PCR products were sent for sequencing (Gene Fanavaran Company, Tehran, Iran). The sequencing results are presented in Figure 1. The sequence analysis of the samples revealed that alleles were not presented in the original sequence of the gene and can be referred to as new alleles. The sequence results were analyzed using FinchTV software. The results confirmed the presence of genotypes of 0R/0R (n = 3), 1R/1R (n = 3), 0R/1R (n = 1), and 2R/2R (n = 1). These sequenced samples were then used as positive controls in HRM real-time PCR.

Visualization of rs132793 XRCC6 PCR Products

The obtained PCR product (337 base pairs [bp]) was amplified by outer forward and reverse primers through Tetra-ARMS PCR. Thereafter, a 235-bp fragment was amplified by outer forward and inner reverse primers, and a 157-bp fragment was amplified by inner forward and outer reverse primers. Consequently, 1 sample was selected and sent for further sequencing (Figure 1).

 
Figure 1. The XRCC5 gene PCR result for sequencing. Genotypes were identified after sequencing. Sample 1 has a heterozygous 1R/0R genotype, samples 2 and 3 have a 0R/0R genotype, sample 4 has a 2R/2R genotype, sample 5 has a 1R/1R genotype, sample 6 has a 1R/0R genotype, and sample 7 has a 1R/1R genotype. In well L, there is a marker that acts as a ruler; the marker is 50 bp.
Figure 1. The XRCC5 gene PCR result for sequencing. Genotypes were identified after sequencing. Sample 1 has a heterozygous 1R/0R genotype, samples 2 and 3 have a 0R/0R genotype, sample 4 has a 2R/2R genotype, sample 5 has a 1R/1R genotype, sample 6 has a 1R/0R genotype, and sample 7 has a 1R/1R genotype. In well L, there is a marker that acts as a ruler; the marker is 50 bp.

 

Association of Clinical Information and Cancer Recurrent

A significant association was found between breast cancer and familial history (P = 0.001). In addition, a meaningful relationship was observed between the time interval of the first chemotherapy and cancer recurrence (P = 0.052) (Table 1).

 
Table 1. Association of clinical information and cancer recurrent

Variable Patient Control P value
 
 
 
BMI
<16.5 0 (0%) 0 (0%)  
 
 
0.447
16.5-18.5 0 (0%) 0 (0%)
18.5-25 14 (46.6%) 13 (43.3%)
25-30 14 (46.6%) 17 (56.6%)
30-35 2 (6.6%) 0 (0%)
35-40 0 (0%) 0 (0%)
>40 0 (0%) 0 (0%)
 
Menstrual age
<11 3 (10%) 1 (3.3%)  
 
0.716
 
 
12 3 (10%) 4 (13.3%)
13 7 (23.3%) 6 (20%)
14 8 (26.6%) 12 (40%)
<15 9 (30%) 7 (23.3%)
Familial history
 
All 12 (40%) 0 (0%) 0.001
None 16 (53.3%) 30 (100%)
Contraceptive consumption None 17 (56.6%) 0 (0%)  
 
0.480
 
LD 6 (20%) 0 (0%)
HD 2 (6.6%) 0 (0%)
LD-HD 5 (16.6%) 0 (0%)
Age at first pregnancy None 2 (6.6%) 4 (13.3%) 0.454
 
<20 18 (60%) 18 (60%)
20-24 3 (10%) 2 (6.6%)
25-29 5 (16.6%) 2 (6.6%)
<30 1 (3.3%) 0 (0%)
Time interval between initial chemotherapy and disease recurrence
(year)
<1 10 (33.3%) 0 (0%) 0.052
1-2 1 (3.3%) 0 (0%)
2-3 8 (26.6%) 0 (0%)
3-4 3 (10%) 0 (0%)

The genotypic and allelic frequency in both XRCC6 and XRCC5 genes

According to the results of XRCC5 genotyping, there was no significant difference between genotype frequencies in the patient and control groups (P = 0.426; Table 4). However, genotypic frequencies of XRCC6 demonstrated a significant difference between the patient and control groups (P = 0.00001).
There was no significant difference between the XRCC5 alleles in the patient and control groups (P = 0.548), while a significant difference was seen in the frequency of XRCC6 alleles (P = 0.03; Table 2).


Table 2. Genotypic and allelic frequency in XRCC5 and XRCC6 genes

 
 
XRCC5
Subjects Genotypes P value
0R/0R 0R/1R 1R/1R 2R/2R
Patients 2 (6.6%) 7 (23.3%) 19 (63.3%) 2 (6.6%)  
 
0.426
Controls 6 (20%) 4 (13.3%) 18 (60%) 2 (6.6%)
Total 8 (13.3%) 11 (18.3%) 37 (61.6%) 4 (6.6%)
    Alleles P value
 
XRCC5
Subjects 0R 1R 2R
Patients 11 (18.3%) 45 (75%) 4 (6.6%) 0.548
Controls 16 (26.6%) 40 (66.6%) 4 (6.6%)
Total 27 (22.5%) 85 (70.8%) 8 (6.6%)
 
 
 
XRCC6
Subjects Genotypes P value
AA AG GG
Patients 0 (0%) 20 (66.7%) 10 (33.3%) 0.00001
Controls 3 (10%) 27 (90%) 0 (0%)
Total 3 (5%) 47 (78.33%) 10 (16.66%)
    Allele P value
 
XRCC6
Subjects A G
Patients 20 (33.3%) 40 (66.67%)  
0.030
Controls 33 (55%) 27 (45%)
Total 53 (44.16%) 67 (55.83%)

Correlation of the Clinical Information of Metastatic Breast Cancer With XRCC5 Genotypes
There was a significant relationship between XRCC5 genotypes and the expression of progesterone receptor (P = 0.068). Moreover, a significant relationship was detected between XRCC5 genotypes and the time interval between the first chemotherapy and cancer recurrence (P = 0.069; Table 3).

 
Table 3. Relationship between clinical characteristics and XRCC5 genotypes

Factor Genotype frequency P value
0R/0R 1R/0R 1R/1R 2R/2R
 
 
Age
<40 1 (3.3%) 0 (0%) 4 (13.3%) 1 (3.3%)  
 
0.602
 
40-49 1 (3.3%) 2 (6.6%) 3 (1%) 1 (3.3%)
50-59 0 (0%) 4 (13.3%) 7 (23.3%) 0 (0%)
60-69 0 (0%) 1 (3.3%) 4 (13.3%) 0 (0%)
>70 0 (0%) 0 (0%) 1 (3.3%) 0 (0%)
 
 
 
BMI
<16.5 0 (0%) 0 (0%) 0 (0%) 0 (0%)  
 
 
0.614
16.5-18.5 0 (0%) 0 (0%) 0 (0%) 0 (0%)
18.5-25 1 (3.3%) 5 (16.6%) 8 (26.6%) 0 (0%)
25-30 1 (3.3%) 2 (6.6%) 9 (30%) 2 (6.6%)
30-35 0 (0%) 0 (0%) 2 (6.6%) 0 (0%)
35-40 0 (0%) 0 (0%) 0 (0%) 0 (0%)
>40 0 (0%) 0 (0%) 0 (0%) 0 (0%)
 
Menstrual age
<11 0 (0%) 1 (3.3%) 1 (3.3%) 1 (3.3%)  
 
0.162
 
 
12 0 (0%) 0 (0%) 2 (6.6%) 1 (3.3%)
13 0 (0%) 3 (10%) 4 (13.3%) 0 (0%)
14 2 (6.6%) 2 (6.6%) 4 (13.3%) 0 (0%)
<15 0 (0%) 1 (3.3%) 8 (26.6%) 0 (0%)
Radiotherapy sessions 0 0 (0%) 2 (6.6%) 5 (16.6%) 1 (3.3%)  
 
0.692
<15 0 (0%) 0 (0%) 4 (13.3%) 1 (3.3%)
16-25 1 (3.3%) 1 (3.3%) 3 (10%) 0 (0%)
<26 1 (3.3%) 4 (13.3%) 7 (23.3%) 0 (0%)
Contraceptive consumption None 1 (3.3%) 3 (10%) 12 (40%) 1 (3.3%)  
 
0.668
 
LD 1 (3.3%) 2 (6.6%) 3 (10%) 0 (0%)
HD 0 (0%) 0 (0%) 2 (6.6%) 0 (0%)
LD-HD 0 (0%) 2 (6.6%) 2 (6.6%) 1 (3.3%)
Age at first pregnancy None 0 (0%) 0 (0%) 2 (6.6%) 0 (0%) 1.000
 
<20 2 (6.6%) 4 (13.3%) 10 (33.3%) 2 (6.6%)
20-24 0 (0%) 1 (3.3%) 2 (6.6%) 0 (0%)
25-29 0 (0%) 2 (6.6%) 3 (10%) 0 (0%)
<30 0 (0%) 0 (0%) 1 (3.3%) 0 (0%)
Age of infection 40 1 (3.3%) 2 (6.6%) 6 (20%) 2 (6.6%) 0.306
<40 1 (3.3%) 5 (16.6%) 13 (43.3%) 0 (0%)
Familial history All 1 (3.3%) 3 (10%) 7 (23.3%) 1 (3.3%) 0.914
None 1 (3.3%) 3 (10%) 11 (36.6%) 1 (3.3%)
Estrogen receptor - 0 (0%) 2 (6.6%) 7 (23.3%) 0 (0%) 0.586
+ 2 (6.6%) 5 (16.6%) 10 (33.3%) 2 (6.6%)
Progesterone receptor - 1 (3.3%) 3 (10%) 13 (43.3%) 0 (0%) 0.068
+ 1 (3.3%) 4 (13.3%) 4 (13.3%) 2 (6.6%)
HER2 - 1 (3.3%) 2 (6.6%) 9 (30%) 1 (3.3%)  
 
 
0.61
+ 1 (3.3%) 2 (6.6%) 2 (6.6%) 0 (0%)
+2 0 (0%) 2 (6.6%) 1 (3.3%) 1 (3.3%)
+3 0 (0%) 1 (3.3%) 3 (10%) 0 (0%)
P53 - 2 (6.6%) 4 (13.3%) 12 (40%) 1 (3.3%) 0.598
+ 0 (0%) 2 (6.6%) 3 (10%) 1 (3.3%)
Stress level None 0 (0%) 3 (10%) 6 (20%) 0 (0%) 0.378
Low 0 (0%) 3 (10%) 5 (16.6%) 0 (0%)
High 2 (6.6%) 1 (3.3%) 8 (26.6%) 2 (6.6%)
Metastasis Lymph nodes 0 (0%) 0 (0%) 2 (6.6%) 0 (0%) 0.571
Lung 1 (3.3%) 2 (6.6%) 2 (6.6%) 1 (3.3%)
Liver 0 (0%) 1 (3.3%) 0 (0%) 0 (0%)
Breast 0 (0%) 1 (3.3%) 0 (0%) 0 (0%)
Bone 0 (0%) 1 (3.3%) 3 (10%) 0 (0%)
Brain 0 (0%) 0 (0%) 1 (3.3%) 0 (0%)
More than 1 metastasis 1 (3.3%) 2 (6.6%) 11 (36.6%) 1 (3.3%)
Tumor degree I 0 (0%) 0 (0%) 0 (0%) 0 (0%) 0.906
II 0 (0%) 1 (3.3%) 4 (13.3%) 0 (0%)
III 2 (6.6%) 4 (13.3%) 12 (40%) 1 (3.3%)
IV 0 (0%) 2 (6.6%) 3 (10%) 1 (3.3%)
Diet Normal 0 (0%) 4 (13.3%) 11 (36.6%) 0 (0%) 0.148
Protein-rich 0 (0%) 1 (3.3%) 3 (10%) 0 (0%)
Fat-rich 1 (3.3%) 1 (3.3%) 4 (13.3%) 2 (6.6%)
Protein- and fat-rich 0 (0%) 1 (3.3%) 0 (0%) 0 (0%)
Caffeine-rich 1 (3.3%) 0 (0%) 1 (3.3%) 0 (0%)
Activity level Inactive 2 (6.6%) 4 (13.3%) 8 (26.6%) 1 (3.3%) 0.851
Normal 0 (0%) 2 (6.6%) 9 (30%) 1 (3.3%)
Active 0 (0%) 1 (3.3%) 2 (6.6%) 0 (0%)
Time interval between initial chemotherapy and disease recurrence
(year)
<1 0 (0%) 4 (13.3%) 5 (16.6%) 1 (3.3%) 0.069
1-2 1 (3.3%) 0 (0%) 0 (0%) 0 (0%)
2-3 1 (3.3%) 0 (0%) 7 (23.3%) 0 (0%)
3-4 0 (0%) 0 (0%) 3 (10%) 0 (0%)
<4 0 (0%) 3 (10%) 3 (10%) 1 (3.3%)

Correlation of the Clinical Information With XRCC6 Genotypes

According to the calculated P values, there was a significant relationship between XRCC6 genotypes and the number of radiotherapy sessions (P = 0.007), as well as a significant relationship between XRCC6 genotypes and HER2 in patients with mild neglect (P = 0.087; Table 4).

 
Table 4. Relationship between clinical characteristics and XRCC6 genotypes

Risk Factor Genotype frequency P value
AA AG GG
Age <40 0(0%) 3 (10%) 3 (10%)  
 
0.884
 
 
 
40-49 0 (0%) 5 (16.6%) 2 (6.6%)
50-59 0 (0%) 8 (26.6%) 3 (10%)
60-69 0 (0%) 3 (10%) 2 (6.6%)
>70 0 (0%) 1 (3.3%) 0 (0%)
 
 
BMI
<16.5 0 (0%) 0 (0%) 0 (0%)  
 
 
1
16.5-18.5 0 (0%) 0 (0%) 0 (0%)
18.5-25 0 (0%) 9 (30%) 5 (16.6%)
25-30 0 (0%) 9 (30%) 5 (16.6%)
30-35 0 (0%) 2 (6.6%) 0 (0%)
35-40 0 (0%) 0 (0%) 0 (0%)
>40 0 (0%) 0 (0%) 0 (0%)
Menstrual age <11 0 (0%) 3 (10%) 0 (0%)  
 
 
0.204
 
12 0 (0%) 3 (10%) 0 (0%)
13 0 (0%) 4 (13.3%) 3 (10%)
14 0 (0%) 3 (10%) 5 (16.6%)
>15 0 (0%) 7 (23.3%) 2 (6.6%)
Radiotherapy sessions None 0 (0%) 5 (16.6%) 2 (6.6%)  
 
0.007
<15 0 (0%) 5 (16.6%) 1 (3.3%)
16-25 0 (0%) 0 (0%) 5 (16.6%)
>26 0 (0%) 10 (33.3%) 2 (6.6%)
Contraceptive consumption None 0 (0%) 11 (36.6%) 6 (20%)  
1
LD 0 (0%) 4 (13.3) 2 (6.6%)
HD 0 (0%) 2 (6.6%) 0 (0%)
LD-HD 0 (0%) 3 (10%) 2 (6.6%)
Age at first birth No birth 0 (0%) 1 (3.3%) 1 (3.3%) 1
<20 0 (0%) 12 (40%) 6 (20%)
20-24 0 (0%) 2 (6.6%) 1 (3.3%)
25-29 0 (0%) 4 (13.3%) 1 (3.3%)
>30 0 (0%) 1 (3.3%) 0 (0%)
Age at disease infection <40 0 (0%) 7 (23.3%) 4 (13.3) 1
>40 0 (0%) 13 (43.3%) 6 (20%)
Menopause + 0 (0%) 13 (43.3%) 6 (20%) 1
- 0 (0%) 7 (23.3%) 4 (13.3%)
Familial history + 0 (0%) 7 (23.3%) 5 (16.6%) 0.698
- 0 (0%) 11 (36.6%) 5 (16.6%)
Estrogen receptor + 0 (0%) 14 (46.6%) 5 (16.6%) 1
- 0 (0%) 6 (20%) 3 (10%)
Progesterone receptor + 0 (0%) 8 (26.6%) 3 (10%) 1
- 0 (0%) 12 (40%) 5 (16.6%)
HER2 +3 0 (0%) 1 (3.3%) 3 (10%) 0.087
+2 0 (0%) 2 (6.6%) 2 (6.6%)
+ 0 (0%) 4 (13.3%) 1 (3.3%)
- 0 (0%) 11 (36.6%) 2 (6.6%)
P53 + 0 (0%) 3 (10%) 3 (10%) 0.344
- 0 (0%) 14 (46.6%) 5 (16.6%)
Stress level None 0 (0%) 6 (20%) 3 (10%) 0.888
Low 0 (0%) 6 (20%) 2 (6.6%)
High 0 (0%) 8 (26.6%) 5 (16.6%)
Metastasis Lymph nodes 0 (0%) 2 (6.6%) 0 (0%) 0.918
Lung 0 (0%) 4 (13.3%) 2 (6.6%)
Liver 0 (0%) 1 (3.3%) 0 (0%)
Breast 0 (0%) 1 (3.3%) 0 (0%)
Bone 0 (0%) 3 (10%) 1 (3.3%)
Brain 0 (0%) 1 (3.3%) 0 (0%)
More than 1 metastasis 0 (0%) 8 (26.6%) 7 (23.3%)
Tumor degree I 0 (0%) 0 (0%) 0 (0%) 0.283
II 0 (0%) 5 (16.6%) 0 (0%)
III 0 (0%) 11 (36.6%) 8 (26.6%)
IV 0 (0%) 4 (13.3%) 2 (6.6%)
Diet Normal 0 (0%) 9 (30%) 6 (20%) 0.539
Protein-rich 0 (0%) 2 (6.6%) 2 (6.6%)
Fat-rich 0 (0%) 7 (23.3%) 1 (3.3%)
Protein- and fat-rich 0 (0%) 1 (3.3%) 0 (0%)
Caffeine-rich 0 (0%) 1 (3.3%) 1 (3.3%)
Activity level
 
 
 
Low 0 (0%) 12 (40%) 3 (10%) 0.24
Normal 0 (0%) 6 (20%) 6 (20%)
High 0 (0%) 2 (6.6%) 1 (3.3%)
Time interval between initial chemotherapy and disease recurrence
(year)
<1 0 (0%) 7 (23.3%) 3 (10%) 0.311
1-2 0 (0%) 0 (0%) 1 (3.3%)
2-3 0 (0%) 6 (20%) 2 (6.6%)
3-4 0 (0%) 1 (3.3%) 2 (6.6%)
>4 0 (0%) 6 (20%) 1 (3.3%)

 

Discussion

Breast cancer is a highly heterogeneous disease caused by the interplay of hereditary and environmental risk factors, leading to the progressive accumulation of genetic and epigenetic changes in breast cells (25). The DNA-dependent protein kinase (DNA-PK) consists of 2 subunits, including DNA-PKcs as a catalytic subunit and a Ku heterodimer. The role of DNA-PK has been appointed in DSBs through the NHEJ pathway (27). Ku70 and Ku80 form the Ku complex and are expressed by the XRCC5 and XRCC6 genes, respectively (28-30). In this study, we evaluated the frequency of rs132793 and rs6147172 polymorphisms in XRCC6 and XRCC5 in patients with metastatic breast cancer and reported their association with clinical-pathological characteristics. Our results revealed that women in the 50-59 age group had the highest percentage (36.7%) of breast cancer. Moreover, no significant difference was found between breast cancer in women and parameters such as age at first pregnancy, contraceptive consumption, and age at first menstruation. However, other factors (including a family history of cancer and age) show a significant relationship between breast cancer and incidence index.
We observed that the genotype frequencies of the XRCC5 gene in the examined subjects were 6.6%, 63.3%, 6.6%, and 23.3% for 0R/0R, 1R/1R, 2R/2R, and 1R/R, respectively. These results indicated no association between this polymorphism in the XRCC5 gene and metastatic breast cancer. Ku80 is a heterodimer encoded by XRCC5, binding to the broken ends of DNA through the NHEJ pathway. The role of XRCC5 can be affected by various factors, including the insertion of VNTR in the promoter region of this gene. This phenomenon can alter the expression of XRCC5, leading to a subsequent change in the synthesis of Ku80. The mentioned process may modify NHEJ and HR pathways, which can consequently lead to the development of cancers, including breast cancer (25). In line with previous studies, AL-Eitan et al evaluated the correlation between VNTR in XRCC5 genotypes and the development of breast cancer. They reported a strong significant correlation between the VNTR polymorphism and breast cancer risk. After performing PCR, they stated a remarkable association between 2R/2R, 3R/2R, and 3R/3R genotypes with breast cancer. Also, the allele frequency showed significant differences between the patient and healthy groups (26). Cui et al investigated the association between the VNTR polymorphism and 3 types of familial breast cancer (BRCA1+, BRCA2+, and wild-type BRCAx) at the germline level. Different techniques, including PCR, PAGE, and Sanger sequencing, were used to compare the VNTR polymorphism of XRCC5 between healthy and breast cancer cases with familial history. The statistical analysis of VNTR genotypes showed significant differences between healthy and 2 mutated groups (BRCA1+ and BRCA2+) but not the BRCAx group. They indicated that in the BRCA1+ group, the increased risk was related to 2R/2R and 2R/1R genotypes, and decreased risk was associated with 1R/1R and 1R/0R genotypes. However, 2R/1R was associated with increased risk factors in the BRCA2+ group. Overall, the different VNTR genotypes of the XRCC5 promoter were related to the altered risk of breast cancer in the mutated carriers (BRCA1+ and BRCA2+ individuals) (25). Regarding myeloma patients, a study on 27 SNPs in XRCC3, XRCC4, and XRCC5 genes reported that rs1051685 in the XRCC5 gene located in the 3′-UTR was associated with the susceptibility of myeloma, while GG genotype carriers remained at a lower risk of cancer development (27). In our study, the XRCC6 gene was found to be associated with breast cancer. The frequencies of AA, GG, and AG genotypes of this gene were 0%, 33.3%, and 66.7%, respectively. Furthermore, XRCC6, as a Ku70 protein-coding gene and a component of the NHEJ pathway, has a key role in the inhibiting rearrangements of chromosomes and preservation of the genome integrity, resulting in the stability of the genome and cell survival. It was suggested that polymorphisms of XRCC6 may have a critical role in tumorigenesis (28). In this regard, Jia et al investigated the association of the XRCC6 polymorphisms with the risk of cancer development in a meta-analysis study. They proposed that the rs132793 polymorphism reduced the risk of breast cancer, while it could increase the incidence of other neoplasia (28). Li et al in 2011 investigated genetic variants of XRCC5/XRCC6 genes and their association with hepatocellular carcinoma (HCC). They assessed the genotypes of 13 common SNPs in these genes and reported a significant relationship between the reduced risks of HCC associated with the XRCC5 rs16855458 polymorphism, as well as a significantly increased risk of HCC associated with the XRCC5 rs9288516 polymorphism. The effects of rs16855458 and rs9288516 were more considerable in the subjects infected with hepatitis B surface antigen compared with non-infected subjects. The haplotype-based analysis revealed that in XRCC5, AA in block 1 and CGGTT in block 2 were associated with decreased risk of HCC. Moreover, XRCC5 variants could determine the susceptibility of HCC, but the reliability of these results requires further studies and validation on a larger scale (29). Besides, the investigation of SNPs in XRCC5 and XRCC6 genes in prostate cancer patients showed that rs2267437 in XRCC6 could be considered a risk factor in aggressive prostate cancer tumors. Compared with CC/CG genotypes, GG genotype-carrying patients showed increased risks of developing bigger tumors. They suggested that these results could be taken into account for malignant prostate cancer tests along with genetic variants of the major vault protein (MVP) gene (30).


 

Conclusion

We evaluated the prognosis of XRCC5 and XRCC6 polymorphisms in 30 patients with metastatic breast cancer undergoing chemotherapy. Our findings showed no significant relationship between the XRCC5 rs6147172 polymorphism and metastatic breast cancer, while a significant relationship was detected between the XRCC6 rs132793 polymorphism and metastatic breast cancer. We speculated that the XRCC6 rs132793 polymorphism could be used as a diagnostic biomarker in breast cancer. In addition, the efficacy of chemotherapy-based approaches can be improved by tracking the rs132793 polymorphism of the XRCC6 gene as a prognostic factor in breast cancer.
 
 

Acknowledgements

None.

 

Conflicts of Interest

Authors declare that they have no conflict of interest.

 

Type of Study: Original Research Article | Subject: Clinical Medicine
Received: 2021/08/17 | Accepted: 2022/08/20 | Published: 2022/12/12

References
1. Jemal A, Siegel R, Ward E, Hao Y, Xu J, Thun MJ. Cancer statistics, 2009. CA Cancer J Clin. 2009;59(4):225-49. [DOI:10.3322/caac.20006] [PMID]
2. Martin TA, Jiang WG. Loss of tight junction barrier function and its role in cancer metastasis. Biochimica et Biophysica Acta (BBA)-Biomembranes. 2009;1788(4):872-91. [DOI:10.1016/j.bbamem.2008.11.005] [PMID]
3. Jiang WG, Sanders AJ, Katoh M, et al.Tissue invasion and metastasis: Molecular, biological and clinical perspectives. Semin Cancer Biol. 2015; 35 Suppl:S244-S275 [DOI:10.1016/j.semcancer.2015.03.008] [PMID]
4. Scully OJ, Bay BH, Yip G, Yu Y. Breast Cancer Metastasis. Cancer Genomics Proteomics . 2012;9(5):311-20.
5. Poste G, Fidler IJ. The pathogenesis of cancer metastasis.Nature. 1980;283(5743):139-46. [DOI:10.1038/283139a0] [PMID]
6. Hunter KW, Crawford NP, Alsarraj J. Mechanisms of metastasis.Breast Cancr Res. 2008;10(1):S2. [DOI:10.1186/bcr1988] [PMID] [PMCID]
7. Mego M, Mani SA, Cristofanilli MJNrCo. Molecular mechanisms of metastasis in breast cancer-clinical applications. Nat Rev Clin Oncol . 2010;7(12):693-701. [DOI:10.1038/nrclinonc.2010.171] [PMID]
8. Wendt MK, Taylor MA, Schiemann BJ, Schiemann WP. Down-regulation of epithelial cadherin is required to initiate metastatic outgrowth of breast cancer.Mol Biol Cell. 2011;22(14):2423-35. [DOI:10.1091/mbc.e11-04-0306] [PMID] [PMCID]
9. Talmadge JE, Fidler IJ. AACR centennial series: the biology of cancer metastasis: historical perspective.Cancer Res. 2010;70(14):5649-69. [DOI:10.1158/0008-5472.CAN-10-1040] [PMID] [PMCID]
10. Paget S. The distribution of secondary growths in cancer of the breast.Cancer Metastasis Rev. 1989;8:98-101.
11. Nicolson GL. Breast cancer metastasis-associated genes: role in tumour progression to the metastatic state. Biochem Soc Sym. 1998;63:231-43.
12. Davis AJ, Chen DJ. DNA double strand break repair via non-homologous end-joining. Transl Cancer Res . 2013;2(3):130.
13. Tseng RC, Hsieh FJ, Shih CM, Hsu HS, Chen CY, Wang YCJC. Lung cancer susceptibility and prognosis associated with polymorphisms in the nonhomologous end‐joining pathway genes: a multiple genotype‐phenotype study.Cancer. 2009;115(13):2939-48. [DOI:10.1002/cncr.24327] [PMID]
14. Dombernowsky SL, Weischer M, Freiberg JJ, et al. Missense polymorphisms in BRCA1 and BRCA2 and risk of breast and ovarian cancer. Cancer Epidemiol Biomarkers Prev 2009;18(8):2339-42. [DOI:10.1158/1055-9965.EPI-09-0447] [PMID]
15. Khanna KK, Jackson SP. DNA double-strand breaks: signaling, repair and the cancer connection. Nature Genet. 2001;27(3):247-54. [DOI:10.1038/85798] [PMID]
16. Evdokimova V, Gandhi M, Rayapureddi J, Stringer JR, Nikiforov YEJE-rc. Formation of carcinogenic chromosomal rearrangements in human thyroid cells after induction of double-strand DNA breaks by restriction endonucleases. Endocr Relat Cancer. 2012; 19(3): 271-81 2012;19(3):271. [DOI:10.1530/ERC-11-0314] [PMID] [PMCID]
17. Siegel R, Ma J, Zou Z, Jemal AJCacjfc. Cancer statistics. CA Cancer J Clin 2014. 2014;64(1):9-29. [DOI:10.3322/caac.21208] [PMID]
18. Li R, Yang Y, An Y, et al. Genetic polymorphisms in DNA double-strand break repair genes XRCC5 , XRCC6 and susceptibility to hepatocellular carcinoma. Carcinogen. 2011;32(4):530-6. [DOI:10.1093/carcin/bgr018] [PMID]
19. Datkhile KD, Patil MN, Durgawale PP, Korabu KS, Joshi SA, Kakade SV. Association of genetic polymorphisms in XRCC4, XRCC5, XRCC6 and XRCC7 in cervical cancer susceptibility from rural population: a hospital based case-control study. Int J. 2018;6(7):2453. [DOI:10.18203/2320-6012.ijrms20182835]
20. Singh A, Singh N, Behera D, Sharma S. Role of polymorphic XRCC6 (Ku70)/XRCC7 (DNA-PKcs) genes towards susceptibility and prognosis of lung cancer patients undergoing platinum based doublet chemotherapy. Molec Biol Rep. 2018;45(3):253-61. [DOI:10.1007/s11033-018-4158-z] [PMID]
21. Patil MN, Datkhile KD, Bhosale SJ, et al. Role of genetic polymorphisms in XRCC4, XRCC5, XRCC6 and XRCC7 in breast cancer susceptibility in rural Indian population: a hospital based case-control study from Maharashtra. Int J Health Sci Res. 2016;6(11):24-32. [DOI:10.18203/2320-6012.ijrms20182835]
22. Lee KM, Choi JY, Kang C, et al. Genetic polymorphisms of selected DNA repair genes, estrogen and progesterone receptor status, and breast cancer risk. Clin Cancer Res. 2005;11(12):4620-6. [DOI:10.1158/1078-0432.CCR-04-2534] [PMID]
23. Fu YP, Yu JC, Cheng TC, et al. Breast cancer risk associated with genotypic polymorphism of the nonhomologous end-joining genes: a multigenic study on cancer susceptibility. Cancer Res. 2003;63(10):2440-6.
24. Abdelbaqi K, Di Paola D, Rampakakis E, Zannis-Hadjopoulos M. Ku protein levels, localization and association to replication origins in different stages of breast tumor progression. J Cancer. 2013;4(5):358-70. [DOI:10.7150/jca.6289] [PMID] [PMCID]
25. Cui J, Luo J, Kim YC, et al. Differences of variable number tandem repeats in XRCC5 promoter are associated with increased or decreased risk of breast cancer in BRCA gene mutation carriers. Front Oncol. 2016;6(92). [DOI:10.3389/fonc.2016.00092] [PMID] [PMCID]
26. AL-Eitan LN, Rababa'h DM, Alghamdi MA, Khasawneh RHJO, Therapy. Genetic association of XRCC5 gene polymorphisms with breast cancer among Jordanian women Onco Targets Ther. 2019;12:7923-8. [DOI:10.2147/OTT.S220226] [PMID] [PMCID]
27. Hayden PJ, Tewari P, Morris DW, et al. Variation in DNA repair genes XRCC3, XRCC4, XRCC5 and susceptibility to myeloma. Human Molec Genet. 2007;16(24):3117-27. [DOI:10.1093/hmg/ddm273] [PMID]
28. Jia J, Ren J, Yan D, Xiao L, Sun R. Association between the XRCC6 polymorphisms and cancer risks: a systematic review and meta-analysis. Medicine (Baltimore). 2015;94(1):e283-e. [DOI:10.1097/MD.0000000000000283] [PMID] [PMCID]
29. Li R, Yang Y, An Y, et al. Genetic polymorphisms in DNA double-strand break repair genes XRCC5, XRCC6 and susceptibility to hepatocellular carcinoma. Carcinogen. 2011;32(4):530-6. [DOI:10.1093/carcin/bgr018] [PMID]
30. Henríquez-Hernández LA, Valenciano A, Foro-Arnalot P, et al. Association between single-nucleotide polymorphisms in DNA double-strand break repair genes and prostate cancer aggressiveness in the Spanish population. Prostate Cancer Prostatic Dis. 2016;19(1):28-34. [DOI:10.1038/pcan.2015.63] [PMID]

Send email to the article author


Rights and permissions
Creative Commons License This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.

© 2026 CC BY-NC 4.0 | Journal of Advances in Medical and Biomedical Research

Designed & Developed by : Yektaweb