Volume 29, Issue 133 (March & April 2021)                   J Adv Med Biomed Res 2021, 29(133): 63-67 | Back to browse issues page


XML Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Ghourchian S, Douraghi M, Baghani A, Soltan Dallal M M. Detection and Frequency of Enterotoxin (cpa,cpe) Genes of Clostridium perfringens Isolated from Dehydrated Vegetables by PCR. J Adv Med Biomed Res 2021; 29 (133) :63-67
URL: http://journal.zums.ac.ir/article-1-5955-en.html
1- Division of Food Microbiology, Dept. of Pathobiology, School of Public Health, Tehran University of Medical Sciences, Tehran, Iran
2- Food Microbiology Research Center, Tehran University of Medical Sciences, Tehran, Iran
3- Division of Food Microbiology, Dept. of Pathobiology, School of Public Health, Tehran University of Medical Sciences, Tehran, Iran , msoltandallal@gmail.com
Full-Text [PDF 358 kb]   (153707 Downloads)     |   Abstract (HTML)  (144278 Views)

✅ Our finding showed that contamination of packed dehydrated vegetables was higher than unpacked; this might be due to drying as well as packaging process. We found that these isolates were negative for enterotoxin.


Full-Text:   (3099 Views)
Introduction
 

Clostridium perfringens ranks among the most widespread bacteria, with an ubiquitous environmental distribution in soil, sewage, food, feces, and the normal intestinal flora of humans and animals (1, 2). According to the Center for Disease Control and Prevention (CDC) estimation, more than one million people are infected by C. perfringens each year (3). Food poisoning can be caused by C. perfringens enterotoxin (CPE) produced by C. perfringens spores in the small intestine, which can germinate in foods such as meat and poultry. Main symptoms of the disease are nausea, abdominal pain, and diarrhea. The disease is usually mild and self-limiting in healthy individuals, with symptoms resolving within 24 hours  (4,5). The CPE is encoded by its gene located on the chromosome or plasmid of the bacterium (6-8). Expression of the CPE is an important determinant of C. perfringens causing food poisoning (9). Available diagnostic tests for the toxin detection are immunoenzymatic assays including latex agglutination, immunodiffusion, immunoelectrophoresis , ELISA, and Western blot. All these tests depend on high quantity of the enterotoxin in samples. Some strains may carry a silent CPE gene, resulting in missed identification of toxigenic strains. One of the reliable and useful methods for the detection of C. perfringens toxins is polymerase chain reaction (PCR). This method does not depend on enterotoxin concentration (10). Many of C. perfringens food poisoning events occur due to the consumption of contaminated meat and poultry products (11). Detection of toxigenic C. perfringens is important because spore forming bacteria are Stable in the environment. The dehydrated vegetables are routinely used in Iran in various foods, including main dishes and herbal medicines. The aim of this study was to isolate and identify C. perfringens in dehydrated vegetables in Iran.

 

Materials and Methods

Sampling
A total of 140 samples of dehydrated green leafy vegetables, including dill, parsley, coriander, tarragon, mint, and mixed vegetables (crumb and soup) were collected from different areas of Tehran, Iran. Samples were collected as unpacked dehydrated vegetables (n=70) and packed (n=70). The study was approved by the Ethics Committee of Tehran University of Medical Sciences (code=IR.TUMS.SPH.REC.1394.775).


Culture and Isolation
 To evaluate the samples, 10 g of dehydrated vegetables was diluted in 90 mL of sterile 0.1% peptone water, then 10 mL of this suspension was added to 10 mL of thioglycollate medium. Two thioglycollate tubes were prepared from each sample, one tube was incubated at 75ᵒC for 30 min for the detection of C. perfringens spores and the second tube was incubated at 37°C in an anaerobic jar with Anaerocult A for 48 h. After enrichment step, the supernatant was discarded, and two drops of the pellets were streaked on sulfite polymyxin sulfadiazine (SPS) agar plates and incubated at 37ᵒ C for 24-48 h in an anaerobic jar. Black colonies on SPS agar were subjected to Gram staining and biochemical tests.
 
Biochemical Tests
Black colonies were assessed for nitrate reduction, gelatinase, production of double zone, motility test, lecithinase production in egg yolk agar, and acid production by lactose and glucose fermentation. The isolates confirmed as C. perfringens were stored at -20ᵒC.


PCR
For genomic DNA extraction, 5-6 colonies grown on SPS agar were inoculated in 200 μl of sterile double distilled water and boiled at 100˚C for 5-10 min. Following the centrifugation at 12,000 g for 3 min, the supernatant was used as the template DNA for PCR assay (12, 13). The specific primers were used to amplify 324 and 233 base pair (bp) of C. perfringens alpha-toxin (CPA) and CPE genes, respectively (Table1). Reference strain of C. perfringens strain CIP 106157 was used as a positive control for detection of CPA and CPE genes. The PCR was performed in a total volume of 20 μL containing 10 μL of master mix (Pishgam, Iran), 10 ng of DNA, 8.5 μL of H2O, and 0.25 mM of each primer (Bioneer, Seoul, South Korea). Thermo cycler (Peqlab, Germany) was set with the following conditions: initial denaturation at 95°C for 5 min and 30 cycles including denaturation at 94°C for 1 min, annealing at 55°C for 2 min, extension at 72°C for 3 min, and final extension at 72°C for 4 min (14). Electrophoresis was performed in 1% agarose gels (Invitrogen, USA) and gel was stained with 0.5 μg ml-1 ethidium bromide (Sigma, USA).

Nucleotide Accession Number
The partial sequence of CPA gene was deposited in GenBank under the accession number of KU166870.
 

Table 1. Specific primer sequences targeting cpa and cpe

Reference Amplicon size (bp) Sequence(5′-3′) Gene
(9) 324 GCTAATGTTACTGCCGTTGA
CC TCTGATACATCGTGTAA
Cpa
(9) 233 GGAGATGGTTGGATATTAGG
GGACCAGCAG TTGTAGATA
Cpe

 
 

Results

Out of 140 samples, 13 (9.3%) were identified as contaminated with C. perfringens. Among the contaminated samples, 9 (12.8%) and 4 (5.7%) samples were from packed and unpacked samples, respectively. Based on dried vegetables breeds showed no contaminations in soap vegetables, while 1 (0.7%) parsley, 2 (1.4%) coriander, 2 (1.4%) mint, 2 (1.4%) tarragon, 3 (2.2%) dill, and 3 (2.1%) vegetable crumble samples were contaminated with C. perfringens. Using duplex PCR, all isolates were positive for CPA gene while all were negative for CPE gene (Figure 1). This finding indicated that the rate of C. perfringens was 12.8% on the packed dehydrated vegetables and 5.7% on unpacked vegetables.
 

Figure1. Duplex PCR for cpa and cpe genes. M: marker 100bp, P: CIP106157 positive control for cpa and cpe genes. N: negative control. Line

Figure1. Duplex PCR for cpa and cpe genes. M: marker 100bp, P: CIP106157 positive control for cpa and cpe genes. N: negative control. Line

 
 

Discussion

Our results showed that there was no relationship between the positive rate of C. perfringens and brand or breed of the vegetables. Although there are many studies on typing and toxin detection of C. perfringens, none of them has investigated the contamination of dried vegetables so far. Dried vegetables are usually used as cooked or undercooked; thus, consumption of these products may result in food illness. In addition, if the products are contaminated with spores, the stability of spore to heat is another problem (15).
Despite the low frequency of CPE positive and C. perfringens in foods especially in meat, poultry, and dried vegetables, these products can be sources of toxins. Various reports showed that the rate of C. perfringens-associated food poisoning varies around the world (11,16, 17). Unfortunately, there is no comprehensive data showing the frequency of C. perfringens in food poisoning in Iran. This could be due to various reasons including difficulty in registration of patient data or short period of symptoms (24 h). In this study, we determined that 9.3% of dehydrated vegetables were contaminated with C. perfringens. This contamination might be due to the presence of spores in dehydrated samples. The spores are resistant to desiccation, heating, and other conditions. In 2009, Sagoo et al. reported that C. perfringens contamination in dried vegetables and spices is 0.4%. In some other studies conducted in the UK (1975, 1985, 1986), the isolation rate of C. perfringens isolation from dried vegetables was 0 to 7.6% (15).
The frequency of C. perfringens isolated from packed vegetables was more than unpacked ones. This finding may be related to inappropriate processing during packaging or lack of hygiene consideration in factory, transportation, and packaging. The isolates were investigated for CPA and CPE genes. Duplex PCR was applied for 13 confirmed isolates, in which all samples were positive for CPA gene and negative for CPE gene. As far as the researchers investigated, no study has been carried out on dehydrated vegetables in Iran yet. But some studies have been carried out in Iran on isolation of C. perfringens from poultry meats. Poursoltani et al. (in 2014) detected six isolates from 180 packed poultry samples. They used multiplex PCR for C. perfringens subtyping and single PCR for netB and tpel genes in poultry with necrotic enteritis symptoms (18). In Iran, Zandi et al. (in 2014) showed that 100% ostrich dung samples were positive for CPA gene. The multiplex PCR method was used that have not been reported in Iran (19). The difference in frequency of contamination may be due to different contamination sources. Erol et al. (2008) used multiplex PCR on ostrich meat, and showed that 12.2% (22/180) isolates were positive for CPA gene but negative for CPE gene (12).


 

Conclusion

Our results showed that 13 (9.3%) samples were contaminated with C. perfringens. However, the bacteria were negative for CPE. The higher contamination rates in packed vegetables compared to unpacked ones might indicate the lack of suitable hygienic considerations on drying and packaging processes.

 

Acknowledgements

This paper is part of a research project approved by the Food Microbiology Research Center, Tehran University of Medical Sciences and Health Services Contract No. 28439. The authors would like to thank Dr. Zahraei Salehi from Tehran Veterinary University for providing us a C. perfringens strain as control.

 

Ethical considerations

Ethical issues (Including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc.) have been completely observed by the authors.

 

Funding and support

This research resulted from an independent research without receiving any financial support.

 

Conflicts of Interest

Authors declared no conflict of interests.

 

Type of Study: Original Research Article | Subject: Clinical Medicine
Received: 2020/03/25 | Accepted: 2020/07/16 | Published: 2020/12/4

References
1. Lindström M, Heikinheimo A, Lahti P, et al.Novel insights into the epidemiology of Clostridium perfringens type A food poisoning. Food microbiol.2011;28(2):192-198. [DOI:10.1016/j.fm.2010.03.020]
2. ScallanE, Hoekstra RM, Angulo FJ,et al. ( 2011). Foodborne illness acquired in the United States-major pathogens. Emerg Infect Dis,17(1).7-15. [DOI:10.3201/eid1701.P11101]
3. Grass JE, Gould LH , Mahon BE. Epidemiology of foodborne disease outbreaks caused by Clostridium perfringens, United States, 1998-2010. Foodborne PathogDis.2013;10(2):131-36. [DOI:10.1089/fpd.2012.1316]
4. Bos J, Smithee L, McClane B, et al.Fatal necrotizing colitis following a foodborne outbreak of enterotoxigenic Clostridium perfringens type A infection. Clin Infect Diseas.2005; 40(10):78-83. [DOI:10.1086/429829]
5. SchneiderK.R, Goodrich-Schneider R, Hubbard MA, Richardson S.(2017). Preventing foodborne illness associated with Clostridium perfringens. FSHN035,1-6.
6. Hassan KA, Elbourne LD, Tetu SG, et al. Genomic analyses of Clostridium perfringens isolates from five toxinotypes. Res Microbiol.2015;166(4):255-263. [DOI:10.1016/j.resmic.2014.10.003]
7. LahtiP, Heikinheimo A, Johansson T, et al. Clostridium perfringens type A strains carrying a plasmid-borne enterotoxin gene (genotype IS1151-cpe or IS1470-like-cpe) as a common cause of food poisoning. J Clin Microbiol.2008; 46(1):371-373. [DOI:10.1128/JCM.01650-07]
8. Ma M, Li J , McClane BA. Genotypic and phenotypic characterization of Clostridium perfringens isolates from Darmbrand cases in post-World War II Germany. Infect immun.2012; 80(12):4354-4363. [DOI:10.1128/IAI.00818-12]
9. Miyamoto K, Li J , McClane BA. Enterotoxigenic Clostridium perfringens: detection and identification. Microbes Environ. 2012;27(4):343-349. [DOI:10.1264/jsme2.ME12002]
10. Abdelrahim AM, Radomski N, Delannoy S, et al. Large-scale genomic analyses and toxinotyping of Clostridium perfringens implicated in foodborne outbreaks in France. Front Microbiol. 2019; 10:777. [DOI:10.3389/fmicb.2019.00777]
11. Lindström M, Heikinheimo A, Lahti P, Korkeala H. Novel insights into the epidemiology of Clostridium perfringens type A food poisoning. Food Microbiol. 2011;28(2):192-8. [DOI:10.1016/j.fm.2010.03.020]
12. Erol I, Goncuoglu M, Ayaz N, et al. Molecular typing of Clostridium perfringens isolated from turkey meat by multiplex PCR. Lett Appl Microbiol.2008, 47(1): 31-34. [DOI:10.1111/j.1472-765X.2008.02379.x]
13. Ossiprandi MC, Zerbini L. Molecular evaluation of the enterotoxigenicity of Clostridium difficile and Clostridium perfringens swine isolates by PCR assays. Adv Microbiol,2013; 3: 154-59. [DOI:10.4236/aim.2013.32024]
14. Miki Y, Miyamoto K, Kaneko-Hirano I,et al. Prevalence and characterization of enterotoxin gene-carrying Clostridium perfringens isolates from retail meat products in Japan. Appl Environ Microbiol. 2008;74(17):5366-72. [DOI:10.1128/AEM.00783-08]
15. Sagoo S k, Little CL, Greenwood M, et al. Assessment of the microbiological safety of dried spices and herbs from production and retail premises in the United Kingdom. Food microbiol.2009; 26(1) 39-43. [DOI:10.1016/j.fm.2008.07.005]
16. Miyamoto K, Li J, McClane BA. Enterotoxigenic Clostridium perfringens: detection and identification. Microbes Environ. 2012;27(4):343-9. [DOI:10.1264/jsme2.ME12002]
17. Kaneko I, Miyamoto K, Mimura K, et al.Detection of enterotoxigenic Clostridium perfringens in meat samples by using molecular methods. Appl Environ Microbiol.2011; 77(21):7526-32. [DOI:10.1128/AEM.06216-11]
18. Poursoltani M, Mohsenzadeh M, Razmyar J. Toxinotyping of Clostridium perfringens strains isolated from packed chicken portions. Iranian J Medl Microbiol.2014; 8(1):9-17.
19. Zandi E, Mohammadabadi M, Ezzatkhah M, et al. Typing of toxigenic isolates of Clostridium perfringensby multiplex PCR in ostrich. Iranian J Appl Anim Sci.2014; 4(4):795-801.

Send email to the article author


Rights and permissions
Creative Commons License This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.

© 2026 CC BY-NC 4.0 | Journal of Advances in Medical and Biomedical Research

Designed & Developed by : Yektaweb